GapFiller

Introduction

De-novo assembly improvement software from Baseclear.

This software should be run hand-in-hand with the SSPACE software, and it should be run afterwards.

Usage

As in SSPACE, a configuration file termed a library file is necessary and is specified by the -l option.

GapFiller.pl -l libraries.txt -s SSPACE_scaffolds.fa -m 30 -o 2 -r 0.7 -n 10 -d 50 -t 10 -T 1 -i 1 -b test

Manual

GapFiller User Manual

GapFiller v1.10 Marten Boetzer - Walter Pirovano, July 2012
email: walter.pirovano@baseclear.com
Citation
--------------If you use GapFiller in a scientific publication, please cite:
Boetzer, M. and Pirovano, W., Towards (almost) closed genomes with
GapFiller, Genome Biology, 13(6), 2012
License
--------------GapFiller can be freely used by academic institutes or non-profit
organizations. Commercial parties need to acquire a license. For more
information a
bout commercial licenses look at our website or email
info@baseclear.com.
What is GapFiller?
--------------GapFiller is a program to close gaps within previously created scaffolds.
Gaps within scaffolds (such as created with SSPACE) are defined as
unknown nucleotides (N's). With GapFiller, the unknown nucleotides are
filled with true nucleotides in order to (try) to close the gap.
Why GapFiller?
--------------GapFiller can be used to close gaps and solve repeated elements or lowcovered regions (that could previously not be assembled).
How to use GapFiller?
--------------GapFiller comes with a number of files.
GapFiller_v1-10.pl
Main program. Perl script for closing gaps.
README
README file. Information about the process, input files/parameter
options, and output files.
MANUAL
This file.
TUTORIAL
Small tutorial on an E.coli dataset.
Bowtie folder
bowtie scripts for mapping the reads to the scaffolds
BWA folder
BWA scripts for mapping the reads to the scaffolds
Example folder
Example scaffolds, read TUTORIAL file.
To run the main script, type;
perl GapFiller.pl
Or
./GapFiller.pl
This will print the options and parameters to the screen. Below is each
parameter explained in detail.

The ‘-l’ library file:
--------------The library file contains information about each library. The library file
contains six columns, each separated by a space. An example of a
library file is;
Lib1 bwa file1.1.fasta file1.2.fasta 400 0.25 FR
Lib1 bowtie file2.1.fasta file2.2.fasta 400 0.25 FR
Lib2 bowtie file3.1.fastq file3.2.fastq 4000 0.5 RF
Each column is explained in more detail below;
Column 1:
--------Name of the library. A short name to keep track of the names of the
libraries. All temporary files and summary statistics are named after this
library name. Libraries that have the same name are considered to also
have the same distance and deviation (column 4 and 5).
Column 2:
--------Name of the aligner, either bowtie, bwa or bwasw. Use bowtie for small
reads (<50bp) and for fast analysis. Use bwa for longer reads (>50 and
<150) and use bwa for very large reads (e.g. 454). BWA and BWA-sw
are run in default mode.
Column 3 & 4:
--------Fasta or fastq files for both ends. For each paired read, one of the reads
should be in the first file, and the other one in the second file. The paired
reads are required to be on the same line. No naming convention of the
reads is required, because names of the headers are not used in the
protocol. Thus names of the headers shouldn’t be the same and do not
require any overlap of names like (…).x and (…).y, as is commonly used
in assembly programs.
In conclusion, each read should be larger than 16 (or the ‘–m’ parameter
if -x 1). If they are shorter, the program will simply omit them from the
whole process.
Column 5 & 6:
--------The fourth column represents the expected/observed inserted size
between paired reads. The fifth column represents the minimum allowed
error. A combination of both means e.g. that with an expected insert size
of 4000 and 0.25 error, the distance can have an error of 4000 * 0.25 =
1000 in either direction. Thus pairs between 3000 and 5000 distance are
valid pairs.
Column 7:
--------The final column indicates the orientation of the paired-reads.
Orientations can be: FF, FR, RF or RR. Where the F stands for -->
orientation, and R for <-- orientation. Orientation of FR thus means that
the pairs are: --><-MAIN PARAMETERS:
The ‘-s’ scaffolds fasta file
--------------The ‘–s’ scaffolds file should be in a fastA format.
GapFiller PARAMETERS:
The ‘–m’ minimum overlap
--------------Minimum number of overlapping bases of the reads with the gap in the
scaffold. Higher ‘-m’ values lead to more accurate gapclosing at the cost
of decreased coverage. We suggest to take a value close to the largest
read length. For example, for a library with 36bp reads, we suggest to
use a -m value between 30 and 35 for reliable gapclosing.
The -o number of reads
--------------Minimum number of reads needed to call a base during gapclosing, also
known as base coverage. The higher the ‘-o’, the more reads are
considered for gapclosing, increasing the reliability of the extension.
The ‘-r’ minimal base ratio
--------------Minimum base ratio used to accept a overhang consensus base. Higher
'-r' value lead to more accurate gapclosing
The ‘-n’ sequence overlap
--------------Minimum overlap required to merge two sequences surrounding the gap.
Overlaps in the final output are shown in lower-case characters.
The ‘-t’ trim sequence
--------------Number of nucleotides to be trimmed of the sequence edges of the gap.
Example for -t 5;
Sequence:
AGATAGATAGTCGTAGATAGATAGATAGCANNNNNNNNNNNNNNGA
TATATATGGCTCATGCTGATCAA
Trimmed :
AGATAGATAGTCGTAGATAGATAGAnnnnnNNNNNNNNNNNNNNnnnn
nATATGGCTCATGCTGATCAA

off, as can be seen by the lower-case 'n'. Usually the edges of the
sequences are low-quality/misassembled sequences, which can cause
the GapFiller to not proper extend the sequences or not close the gap
because no overlap can be found.
The ‘-d’ gapclose difference
--------------Window that specifies the difference between the gapclosed length and
the original gapsize. If the length of the gapclosed sequence deviates too
much from the original gapsize, gapclosing is either stopped (if >
difference) or sequences are not merged (< difference).
BOWTIE MAPPING PARAMETERS:
The '-g' maximum gaps
--------------Maximum allowed gaps for Bowtie. This option corresponds to the -v
option in Bowtie. The more gaps allowed, the slower the alignment of the
reads.
The '-T' number of threads
--------------Number of search threads for reading in the files and mapping of the
reads.
ADDITIONAL PARAMETERS:
The ‘-b’ prefix base name
--------------All files start with the ‘-b’ prefix to allow for multiple runs on the same
folder without overwriting the results.
The ‘-i’ number of iterations
--------------Number of iterations to fill the gaps. It re-uses the initial reads and maps
them against the remaining gaps. If no more reads are closed, compared
with the previous number of gaps, the process is stopped. Otherwise, it
will keep on closing until the specified number of iterations are finished.

Installation notes

The GapFiller.pl program kept on giving ":no such file or directory" error. This was due to invisible line terminations. This can be set right with "set fileformat=unix" in vim.