Difference between revisions of "Repeatmasker"
Line 84: | Line 84: | ||
* S288_maniid.fsa.out | * S288_maniid.fsa.out | ||
* S288_maniid.fsa.out.gff (this is gff2 format) | * S288_maniid.fsa.out.gff (this is gff2 format) | ||
− | * S288_maniid.fsa.tbl | + | * S288_maniid.fsa.tbl, a summary table of the run (actually given below) |
= RepeatMasker's helpfile = | = RepeatMasker's helpfile = |
Revision as of 16:50, 2 November 2017
Contents
Inroduction
Mainstay repeat analysis program. Porbably getting a it old now, depends too much on RepBase, but equally it is building alighnment with Dfam (which is a more modern approach to repeat finding.
Typical launch command lines
This command slow searches with 8 processors, defines an output directory called rp0, requests gff output and uses the ncbi engine:
Beware: the output directory must be created beforehand.
RepeatMasker -species yeast -pa 8 -dir rp0 -gff -e ncbi -s W303LYZE.fasta
output
Here is what normal output output looks like
================================================== file name: S288_maniid.fsa sequences: 17 total length: 12157105 bp (12157105 bp excl N/X-runs) GC level: 38.15 % bases masked: 618839 bp ( 5.09 %) ================================================== number of length percentage elements* occupied of sequence -------------------------------------------------- Retroelements 500 401795 bp 3.31 % SINEs: 0 0 bp 0.00 % Penelope 0 0 bp 0.00 % LINEs: 0 0 bp 0.00 % CRE/SLACS 0 0 bp 0.00 % L2/CR1/Rex 0 0 bp 0.00 % R1/LOA/Jockey 0 0 bp 0.00 % R2/R4/NeSL 0 0 bp 0.00 % RTE/Bov-B 0 0 bp 0.00 % L1/CIN4 0 0 bp 0.00 % LTR elements: 500 401795 bp 3.31 % BEL/Pao 0 0 bp 0.00 % Ty1/Copia 444 377343 bp 3.10 % Gypsy/DIRS1 56 24452 bp 0.20 % Retroviral 0 0 bp 0.00 % DNA transposons 0 0 bp 0.00 % hobo-Activator 0 0 bp 0.00 % Tc1-IS630-Pogo 0 0 bp 0.00 % En-Spm 0 0 bp 0.00 % MuDR-IS905 0 0 bp 0.00 % PiggyBac 0 0 bp 0.00 % Tourist/Harbinger 0 0 bp 0.00 % Other (Mirage, 0 0 bp 0.00 % P-element, Transib) Rolling-circles 0 0 bp 0.00 % Unclassified: 19 50995 bp 0.42 % Total interspersed repeats: 452790 bp 3.72 % Small RNA: 6 12034 bp 0.10 % Satellites: 0 0 bp 0.00 % Simple repeats: 2981 128642 bp 1.06 % Low complexity: 536 25466 bp 0.21 % ================================================== * most repeats fragmented by insertions or deletions have been counted as one element The query species was assumed to be saccharomyces cerevisiae RepeatMasker Combined Database: Dfam_Consensus-20170127, RepBase-20170127 run with rmblastn version 2.6.0+
Note that the running output (the above is only a summary) mentions Ecoli lot, so it's comforting to know that it analysed the right species.
result files
You should have the following files as output (names reflect above experiments, yours will differ)
- S288_maniid.fsa.cat.gz
- S288_maniid.fsa.masked
- S288_maniid.fsa.out
- S288_maniid.fsa.out.gff (this is gff2 format)
- S288_maniid.fsa.tbl, a summary table of the run (actually given below)
RepeatMasker's helpfile
RepeatMasker version open-4.0.7 No query sequence file indicated NAME RepeatMasker - Mask repetitive DNA SYNOPSIS RepeatMasker [-options] <seqfiles(s) in fasta format> DESCRIPTION The options are: -h(elp) Detailed help Default settings are for masking all type of repeats in a primate sequence. -e(ngine) [crossmatch|wublast|abblast|ncbi|hmmer|decypher] Use an alternate search engine to the default. -pa(rallel) [number] The number of processors to use in parallel (only works for batch files or sequences over 50 kb) -s Slow search; 0-5% more sensitive, 2-3 times slower than default -q Quick search; 5-10% less sensitive, 2-5 times faster than default -qq Rush job; about 10% less sensitive, 4->10 times faster than default (quick searches are fine under most circumstances) repeat options -nolow /-low Does not mask low_complexity DNA or simple repeats -noint /-int Only masks low complex/simple repeats (no interspersed repeats) -norna Does not mask small RNA (pseudo) genes -alu Only masks Alus (and 7SLRNA, SVA and LTR5)(only for primate DNA) -div [number] Masks only those repeats < x percent diverged from consensus seq -lib [filename] Allows use of a custom library (e.g. from another species) -cutoff [number] Sets cutoff score for masking repeats when using -lib (default 225) -species <query species> Specify the species or clade of the input sequence. The species name must be a valid NCBI Taxonomy Database species name and be contained in the RepeatMasker repeat database. Some examples are: -species human -species mouse -species rattus -species "ciona savignyi" -species arabidopsis Other commonly used species: mammal, carnivore, rodentia, rat, cow, pig, cat, dog, chicken, fugu, danio, "ciona intestinalis" drosophila, anopheles, elegans, diatoaea, artiodactyl, arabidopsis, rice, wheat, and maize Contamination options -is_only Only clips E coli insertion elements out of fasta and .qual files -is_clip Clips IS elements before analysis (default: IS only reported) -no_is Skips bacterial insertion element check Running options -gc [number] Use matrices calculated for 'number' percentage background GC level -gccalc RepeatMasker calculates the GC content even for batch files/small seqs -frag [number] Maximum sequence length masked without fragmenting (default 60000, 300000 for DeCypher) -nocut Skips the steps in which repeats are excised -noisy Prints search engine progress report to screen (defaults to .stderr file) -nopost Do not postprocess the results of the run ( i.e. call ProcessRepeats ). NOTE: This options should only be used when ProcessRepeats will be run manually on the results. output options -dir [directory name] Writes output to this directory (default is query file directory, "-dir ." will write to current directory). -a(lignments) Writes alignments in .align output file -inv Alignments are presented in the orientation of the repeat (with option -a) -lcambig Outputs ambiguous DNA transposon fragments using a lower case name. All other repeats are listed in upper case. Ambiguous fragments match multiple repeat elements and can only be called based on flanking repeat information. -small Returns complete .masked sequence in lower case -xsmall Returns repetitive regions in lowercase (rest capitals) rather than masked -x Returns repetitive regions masked with Xs rather than Ns -poly Reports simple repeats that may be polymorphic (in file.poly) -source Includes for each annotation the HSP "evidence". Currently this option is only available with the "-html" output format listed below. -html Creates an additional output file in xhtml format. -ace Creates an additional output file in ACeDB format -gff Creates an additional Gene Feature Finding format output -u Creates an additional annotation file not processed by ProcessRepeats -xm Creates an additional output file in cross_match format (for parsing) -no_id Leaves out final column with unique ID for each element (was default) -e(xcln) Calculates repeat densities (in .tbl) excluding runs of >=20 N/Xs in the query SEE ALSO Crossmatch, ProcessRepeats COPYRIGHT Copyright 2007-2014 Arian Smit, Institute for Systems Biology AUTHORS Arian Smit <asmit@systemsbiology.org> Robert Hubley <rhubley@systemsbiology.org>
Installation requirements
- variouus Perl modules
- trf: Tandem Repeats Finder, only seems necessary for the subprogram RepeatProteinMask
- One of the following: cross_match, wublast y rmblast. However, cross_match not recommeneded (slow code in C from 1998). Best off using the 64-bit rmblast binary.
- The Repeat library/database from GIRI.
Installation method
- Unfortunately it is interactive which means it will be geared towards the single computer installation, which is fine if using a laptop, but not a cluster. Also the tab complete won't work, which is annoying.
Typical messages that are output:
- Building monolithic RM database ...
- Building RMBlast frozen libraries ...
Lo recomendado es uitlizar RMBlast, pero hay una opción para incluir nhmmer y DFAM también .. puede ser util. No mencionan que nhmmerscan también es parte de nhmmer, y los dos forman parte del HMMER.
Mensaje al final: Add a Search Engine: 1. CrossMatch: [ Un-configured ] 2. RMBlast - NCBI Blast with RepeatMasker extensions: [ Configured, Default ] 3. WUBlast/ABBlast (required by DupMasker): [ Un-configured ] 4. HMMER3.1 & DFAM: [ Configured ] 5. Done Enter Selection: 5 -- Setting perl interpreter... Congratulations! RepeatMasker is now ready to use. The program is installed with a full version of the repeat library: DFAM Library Version = Dfam_1.2 RMLibrary Version = 20140131 Repbase Version = 20140131 Further documentation on the program may be found here: /share/apps/src/RepeatMasker-open-4-0-5/repeatmasker.help
Repeat Library (RepBase) Updating
Access (the first time) must be requested from GIRINST
- EMBL format (59.08 MB) 11-10-2012: "Local: RepBase17.11.embl.tar.gz"
- FASTA format (28.76 MB) 11-10-2012: "Local: RepBase17.11.fasta.tar.gz"
- Repeatmasker editions: "Local:repeatmaskerlibraries-20090604.tar.gz (11.27 MB)" y "Local:repeatmaskerlibraries-20120418.tar.gz (26.76 MB)". Creo que solo hay que elegir uno de estos dos
- REPET edition: "Local:RepBase17.11_REPET.embl.tar.gz (28.77 MB)"
Efectivamente, sólo se requiere uno de estos ficheros: el "repeatmaskerlibraries-20120418.tar.gz" que contiene el fichero RepeatMaskerLib.embl que tiene el mismo nombre y se encuentra en el mismo directorio del que vino con el propio RepeatMasker, pero que es mucho más grande.
De todas formas, Repeatmasker se va quejar si no es el RepeatMaskerLib.embl del GIRI.
¿Y dónde meter este fichero? En el subdirectorio "Libraries" del source de RepeatMasker
Para actualizar estas BBDD, se acude al sitio web de giri y se utiliza el userid ramonf con contraseña u9xyvu.
Modificaciones a los principales scripts
Los principales scripts son: Ha que pedir permiso para registrarse en la web de GIRI y descargar los ficheros. Los ficheros son los siguientes:
- RepeatMasker
- ProcessRepeats
- DateRepeats
Hay que cambiar la primera línea al interprete de Perl.
Por otro lado, es necesario informar a RepeatMasker sobre la ubicación exacta de los principales ejecutables, pero al contrario de los que dicen los documentos, se deben identificar en el fichero RepeatMaskerConfig.tmpl en vez del fichero llamado RepeatMasker.
Pequeño Test
Sólo queremos asegurarnos que se puede ejecutar el Repeatmasker sin arrojar errores de la siguiente manera. El propio ejecutable RepeatMasker es un perl script. Primero es bueno asegurarse que el RepeatMasker está en el PATH del usuario. En el fatnode, el PATH de RepeatMasker es
/opt/src/RepeatMasker-open-3-3-0-p1/
Repeatmasker tiene varias opciones, pero para una análisis rápido, la opción -gccalc se puede usar. Por tanto, si teneos el siguietne fichero de entrada
>Sequence1 ACGTGCGCGATCGCCTGCTAGGCGTACGTCGCAG GCACTGGCAGATCGATGTGCTAGATCAGATGACA >Sequence2 GGGCTATTCCGATTAGCACCACATACATCGCTCA
con el nombre in.seq podemos ejecutar lo siguiente:
RepeatMasker -gccalc in.seq
Este fichero no va a tener un resultado sustancial para el programa, pero el objetivo era encontrar errores de instalación de RepeatMasker y nada más.