Rf at 15:07, 1 September 2016

2016-09-01T15:07:04Z

Rf at 15:05, 1 September 2016

2016-09-01T15:05:06Z

Rf: Created page with "= Introduction = De-novo assembly improvement software from Baseclear. This software should be run hand-in-hand with the SSPACE software, and it should be run afterwards...."

2016-09-01T14:42:24Z

Created page with "= Introduction = De-novo assembly improvement software from Baseclear. This software should be run hand-in-hand with the SSPACE software, and it should be run afterwards...."

New page

= Introduction =

De-novo assembly improvement software from Baseclear.

This software should be run hand-in-hand with the SSPACE software, and it should be run afterwards.

= Usage =

As in SSPACE, a configuration file is necessary and is specified by the '''-l''' option.

GapFiller.pl -l libraries.txt -s SSPACE_scaffolds.fa -m 30 -o 2 -r 0.7 -n 10 -d 50 -t 10 -T 1 -i 1 -b test

@@ Line 7: / Line 7: @@
 = Usage =
-As in SSPACE, a configuration file is necessary and is specified by the '''-l''' option.
+As in SSPACE, a configuration file termed a library file is necessary and is specified by the '''-l''' option.
   GapFiller.pl -l libraries.txt -s SSPACE_scaffolds.fa -m 30 -o 2 -r 0.7 -n 10 -d 50 -t 10 -T 1 -i 1 -b test
@@ Line 154: / Line 154: @@
   with the previous number of gaps, the process is stopped. Otherwise, it
   will keep on closing until the specified number of iterations are finished.

← Older revision		Revision as of 15:05, 1 September 2016
Line 10:		Line 10:

	GapFiller.pl -l libraries.txt -s SSPACE_scaffolds.fa -m 30 -o 2 -r 0.7 -n 10 -d 50 -t 10 -T 1 -i 1 -b test		GapFiller.pl -l libraries.txt -s SSPACE_scaffolds.fa -m 30 -o 2 -r 0.7 -n 10 -d 50 -t 10 -T 1 -i 1 -b test
		+
		+	= Manual =
		+
		+	GapFiller User Manual
		+
		+	GapFiller v1.10 Marten Boetzer - Walter Pirovano, July 2012
		+	email: walter.pirovano@baseclear.com
		+	Citation
		+	--------------If you use GapFiller in a scientific publication, please cite:
		+	Boetzer, M. and Pirovano, W., Towards (almost) closed genomes with
		+	GapFiller, Genome Biology, 13(6), 2012
		+	License
		+	--------------GapFiller can be freely used by academic institutes or non-profit
		+	organizations. Commercial parties need to acquire a license. For more
		+	information a
		+	bout commercial licenses look at our website or email
		+	info@baseclear.com.
		+	What is GapFiller?
		+	--------------GapFiller is a program to close gaps within previously created scaffolds.
		+	Gaps within scaffolds (such as created with SSPACE) are defined as
		+	unknown nucleotides (N's). With GapFiller, the unknown nucleotides are
		+	filled with true nucleotides in order to (try) to close the gap.
		+	Why GapFiller?
		+	--------------GapFiller can be used to close gaps and solve repeated elements or lowcovered regions (that could previously not be assembled).
		+	How to use GapFiller?
		+	--------------GapFiller comes with a number of files.
		+	GapFiller_v1-10.pl
		+	Main program. Perl script for closing gaps.
		+	README
		+	README file. Information about the process, input files/parameter
		+	options, and output files.
		+	MANUAL
		+	This file.
		+	TUTORIAL
		+	Small tutorial on an E.coli dataset.
		+	Bowtie folder
		+	bowtie scripts for mapping the reads to the scaffolds
		+	BWA folder
		+	BWA scripts for mapping the reads to the scaffolds
		+	Example folder
		+	Example scaffolds, read TUTORIAL file.
		+	To run the main script, type;
		+	perl GapFiller.pl
		+	Or
		+	./GapFiller.pl
		+	This will print the options and parameters to the screen. Below is each
		+	parameter explained in detail.
		+
		+	The ‘-l’ library file:
		+	--------------The library file contains information about each library. The library file
		+	contains six columns, each separated by a space. An example of a
		+	library file is;
		+	Lib1 bwa file1.1.fasta file1.2.fasta 400 0.25 FR
		+	Lib1 bowtie file2.1.fasta file2.2.fasta 400 0.25 FR
		+	Lib2 bowtie file3.1.fastq file3.2.fastq 4000 0.5 RF
		+	Each column is explained in more detail below;
		+	Column 1:
		+	--------Name of the library. A short name to keep track of the names of the
		+	libraries. All temporary files and summary statistics are named after this
		+	library name. Libraries that have the same name are considered to also
		+	have the same distance and deviation (column 4 and 5).
		+	Column 2:
		+	--------Name of the aligner, either bowtie, bwa or bwasw. Use bowtie for small
		+	reads (<50bp) and for fast analysis. Use bwa for longer reads (>50 and
		+	<150) and use bwa for very large reads (e.g. 454). BWA and BWA-sw
		+	are run in default mode.
		+	Column 3 & 4:
		+	--------Fasta or fastq files for both ends. For each paired read, one of the reads
		+	should be in the first file, and the other one in the second file. The paired
		+	reads are required to be on the same line. No naming convention of the
		+	reads is required, because names of the headers are not used in the
		+	protocol. Thus names of the headers shouldn’t be the same and do not
		+	require any overlap of names like (…).x and (…).y, as is commonly used
		+	in assembly programs.
		+	In conclusion, each read should be larger than 16 (or the ‘–m’ parameter
		+	if -x 1). If they are shorter, the program will simply omit them from the
		+	whole process.
		+	Column 5 & 6:
		+	--------The fourth column represents the expected/observed inserted size
		+	between paired reads. The fifth column represents the minimum allowed
		+	error. A combination of both means e.g. that with an expected insert size
		+	of 4000 and 0.25 error, the distance can have an error of 4000 * 0.25 =
		+	1000 in either direction. Thus pairs between 3000 and 5000 distance are
		+	valid pairs.
		+	Column 7:
		+	--------The final column indicates the orientation of the paired-reads.
		+	Orientations can be: FF, FR, RF or RR. Where the F stands for -->
		+	orientation, and R for <-- orientation. Orientation of FR thus means that
		+	the pairs are: --><-MAIN PARAMETERS:
		+	The ‘-s’ scaffolds fasta file
		+	--------------The ‘–s’ scaffolds file should be in a fastA format.
		+	GapFiller PARAMETERS:
		+	The ‘–m’ minimum overlap
		+	--------------Minimum number of overlapping bases of the reads with the gap in the
		+	scaffold. Higher ‘-m’ values lead to more accurate gapclosing at the cost
		+	of decreased coverage. We suggest to take a value close to the largest
		+	read length. For example, for a library with 36bp reads, we suggest to
		+	use a -m value between 30 and 35 for reliable gapclosing.
		+	The -o number of reads
		+	--------------Minimum number of reads needed to call a base during gapclosing, also
		+	known as base coverage. The higher the ‘-o’, the more reads are
		+	considered for gapclosing, increasing the reliability of the extension.
		+	The ‘-r’ minimal base ratio
		+	--------------Minimum base ratio used to accept a overhang consensus base. Higher
		+	'-r' value lead to more accurate gapclosing
		+	The ‘-n’ sequence overlap
		+	--------------Minimum overlap required to merge two sequences surrounding the gap.
		+	Overlaps in the final output are shown in lower-case characters.
		+	The ‘-t’ trim sequence
		+	--------------Number of nucleotides to be trimmed of the sequence edges of the gap.
		+	Example for -t 5;
		+	Sequence:
		+	AGATAGATAGTCGTAGATAGATAGATAGCANNNNNNNNNNNNNNGA
		+	TATATATGGCTCATGCTGATCAA
		+	Trimmed :
		+	AGATAGATAGTCGTAGATAGATAGAnnnnnNNNNNNNNNNNNNNnnnn
		+	nATATGGCTCATGCTGATCAA
		+
		+	off, as can be seen by the lower-case 'n'. Usually the edges of the
		+	sequences are low-quality/misassembled sequences, which can cause
		+	the GapFiller to not proper extend the sequences or not close the gap
		+	because no overlap can be found.
		+	The ‘-d’ gapclose difference
		+	--------------Window that specifies the difference between the gapclosed length and
		+	the original gapsize. If the length of the gapclosed sequence deviates too
		+	much from the original gapsize, gapclosing is either stopped (if >
		+	difference) or sequences are not merged (< difference).
		+	BOWTIE MAPPING PARAMETERS:
		+	The '-g' maximum gaps
		+	--------------Maximum allowed gaps for Bowtie. This option corresponds to the -v
		+	option in Bowtie. The more gaps allowed, the slower the alignment of the
		+	reads.
		+	The '-T' number of threads
		+	--------------Number of search threads for reading in the files and mapping of the
		+	reads.
		+	ADDITIONAL PARAMETERS:
		+	The ‘-b’ prefix base name
		+	--------------All files start with the ‘-b’ prefix to allow for multiple runs on the same
		+	folder without overwriting the results.
		+	The ‘-i’ number of iterations
		+	--------------Number of iterations to fill the gaps. It re-uses the initial reads and maps
		+	them against the remaining gaps. If no more reads are closed, compared
		+	with the previous number of gaps, the process is stopped. Otherwise, it
		+	will keep on closing until the specified number of iterations are finished.

GapFiller - Revision history

Rf at 15:07, 1 September 2016

Rf at 15:05, 1 September 2016

Rf: Created page with "= Introduction = De-novo assembly improvement software from Baseclear. This software should be run hand-in-hand with the SSPACE software, and it should be run afterwards...."