Primer Search

Minimum length of 3‚match (enter value between 11 and 26):    

Enter the nucleotide sequence to check! For example:

>spo13.yeast
ggaaatgtattaattaggagtatattgagaaatagccgccgacaaaaaggaagtctcataaaagtgtcta
acagacaattagcgcaataagaagaaagaaaacggattgaagttgagtcgagaataattatggcacccag
aaaacgctttaggctactcgaattagggtcaccaacacattctaaaaggaaagttcaaaaacctcttcaa
gagaagaccccaaacttgcgagtttctccacttgcttttaaaattggtaaagaaatcaagaataaggaaa
tcagaaaaacaaaaaaaacagaatcagaaaatatattcaattcgaaacatgtcgatttaagactagaaag
cccacatccaggattaaattttgtaagtgatgctcaacagtactcaaaggctggagatgttcgatatttg
aaaaataaatcaagcaataccttgaaaaacgaaagacaaacaatagagcgcccctcatttgataattcct
taaggttcgaggacattgagcagcctccaaaatctacttcaacgccggttctttctcaatcttctcaaat
aaatgtagaaagagaagcacccatgtttccagttccttactatattgctccttctcctatgtataatttt
agcccgtatcaaaatttcgttggaaacccaacgttcctgacgccaagtcataacccaaacctaaactatg
ccattcccatccaacggccggagttgctttatccgaatgttaacgtatacgattcgccattgtttaagaa
aacaagactgccccatcagaccaaaagtctagataaagaaaaaaattaccaatatcttccaatatatccg
gtctcgatttctaataacggagattttgttggccaagagacaccaagggcagcaccaaagttaagtaaaa
agagactttcaaatacattggatgttaattgttccgattatgagtctagtggacaaaatgcaacttataa
tgatagtgagtcttcccttaattaaaaagattagtttactttttctgtagaatgttaattagtttattgc
atagaaaatctttaatactgaatgacaaaatagtgagtcttcccttaattaaaa
      


Author: Michael Rebhan / Lutz Gehlen
Current Maintainer: ...