HFO Primer Search

Paste nucleotide sequence you are querying in following box:


You may set a minimum length for 3-prime match (subject to min. and max. values of 11 and 26):    

Some examples:

>query_sequence_1
acagacaattataggcttagtgatataagcctaacctcaattcccagtcgagaataattatggcacccag
aaaacgctttaggctactcgaattagggtcaccaacacattctaaaaggaaagactatctggtgaaagcg
gagaagaccccaaacttgcgagtttctccacttgcttttaaaattggtaaagaaatcaagaataaggaaa

or:

>query_sequence_2
tcagaaaaacaaaaaaaacagaatcagaaaatatattcaattcgaaacatgtcgatttaagactagaaag
taatgaatcggccggaaatgtattaattaggagtatattgagaaatagccgccgacaaaaaggaag