FastQCFastQC Report
Tue 15 Mar 2016
9-Wingbud17B2_131203_L003_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename9-Wingbud17B2_131203_L003_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20452626
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT299120.14625016856026216No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCCCGA22950.028.524061
CCGCACC166050.028.31128960-61
GCCCCGT23550.026.1182961
GACTTAG175800.025.64217846-47
ACCTTCG184800.025.41367764-65
CGGTACC36800.025.0821085
CCCCCGT31850.024.9676041
GTGTGAC182750.024.76768942-43
CCCCGTT51100.024.159792
GCCCGGT27750.023.5901682
CATGCGG65150.023.4450249
TCCATAC214200.022.58567494
GCCTAAC41600.022.284192
TTCCGCA210350.022.21146658-59
CCCCGAT22700.022.0641252
CTTAGTA212600.021.32547648-49
CCGGTAC39450.021.1599354
CTTCGCC227950.020.90354566-67
TGCTGAC215500.020.88084828-29
CCTGTGG61300.020.82635194