FastQCFastQC Report
Tue 15 Mar 2016
9-Wingbud17B2_131203_L003_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename9-Wingbud17B2_131203_L003_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20452626
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG648070.3168639567359223No Hit
GGTATGTGGGAGAAGGTATGGAAGAAGGAGAGTTCTCTGAAGCCCGTGAG592890.2898845360982008No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT306650.14993184738233614No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT241920.11828309968607453No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAGGAGG230600.031.113483
GAGGTGA214950.030.2404589
ACCCTAT134150.027.78432514-15
AGGAGGT236800.027.6947047
GTCATCC138350.027.66185650-51
ACCAGGC152800.027.50270778-79
GCAGGAG256700.027.1424062
TGCAGGA262850.026.6762471
ACTCTGT269850.025.90897294
GGTATGT242550.025.6825311
CGGGGGT29500.025.5991428
CTCTACC150250.025.1216522-23
TGACTAG74950.024.94230794
GACCCTA133850.024.78945514-15
GGAGGTG269700.024.7338168
CCTATTC154500.024.37671516-17
CAGGCTT175550.024.17255480-81
GTGACCC142750.023.22418812-13
ATGTGGG271950.023.212094
CCAGGCT163850.023.02101380-81