FastQCFastQC Report
Tue 15 Mar 2016
9-Wingbud17B2_131203_L003_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename9-Wingbud17B2_131203_L003_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences357190
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG5110.14306111593269688No Hit
GGTATGTGGGAGAAGGTATGGAAGAAGGAGAGTTCTCTGAAGCCCGTGAG4120.11534477448976735No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAGTCGG259.5511955E-486.5927794
GCGGACC350.003628832361.85198294
ACACGTC1500.046.184458
ATCGGAA1900.045.57514694
CACGTCT1600.043.3777859
CACACGT1600.043.2734077
CGGGGGT652.3062421E-741.4475868
GCACACG1900.036.39446
AATCGGA1409.5351425E-936.08032294
TTGCTAG1803.6907295E-935.6917592-93
CGGTTCG551.1277367E-535.38157384-85
GCTAGAA1501.1695283E-633.6749794
GAGCACA2050.033.4195944
TGCGGGG1058.1472535E-932.928276
GAGTACG1101.2369128E-831.547489
CGTAGGC500.00477569730.4574951
AATGCGG1002.1168125E-730.4489614
AAATCGG1650.030.31177792-93
GGGGGTA902.899389E-629.9895789
AGAGCAC2300.029.782863