FastQCFastQC Report
Tue 15 Mar 2016
8-Wingbud17B1_131203_L002_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename8-Wingbud17B1_131203_L002_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences24173564
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT329990.13650862570368194No Hit
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT258900.10710046727077563No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCCACG59100.036.7579594
CCCCCGA37900.029.1589931
CCTGACC78050.025.6457883
CCCCGTA39500.025.6182922
GCCCCGT29850.024.8304481
CCCCCGT40500.024.5473941
CCCCGAT34450.022.0302432
CGGTACC54950.021.5747385
TGACCTA92450.021.4685465
GGGGGTT61400.021.2515871
CTGACCT93850.021.186354
CCCGCCG52550.021.11670594
GGGCCGT26750.021.071351
GCCTAAC48700.021.05212
CGGTCTA50000.020.96676380-81
GGCCCCT37900.020.9616851
ACCTGAC85650.020.8828642
GGGGGGT36150.020.871471
GACCTAA96300.020.713486
CCCCGAA54650.020.7091582