FastQCFastQC Report
Tue 15 Mar 2016
8-Wingbud17B1_131203_L002_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename8-Wingbud17B1_131203_L002_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences369534
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC4790.12962271401278366No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATACCG200.00546177755.79374390-91
TCCGGCC850.001910694936.7070592-93
TGCGGGG651.676494E-533.3895386
GGGGGTA1159.949872E-1031.5308699
AGACCAC1601.8189894E-1229.4296538
CGGGGGT904.7185567E-628.1719768
TCGGTCT905.682079E-627.50717486-87
ATGCGGG806.9750284E-527.0959345
CGTCGGT1006.8243935E-726.63689482-83
GGTATAC550.0098240526.2748455
CGCTATC1058.940697E-825.73826274-75
AATGCGG851.0583017E-425.4847984
CAGACCA1859.094947E-1225.4388587
GCCGGGG2300.025.1222523
GAGTACG750.001489966524.1736669
GCAGACC1952.0008883E-1124.1146686
CGGTCTC901.7943267E-423.57757686-87
CCGGGGA2500.023.1062184
GTCGGTC1052.3206638E-522.94190884-85
TAGGACG800.002213841522.5830022