FastQCFastQC Report
Tue 15 Mar 2016
7-Wingbud11B2_131203_L002_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename7-Wingbud11B2_131203_L002_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences21541433
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG297990.13833341542319863No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCAACG44850.028.9685781
GAGCGCG42050.019.4482889
GCAACGA74200.019.1458632
TGAGCGC45800.018.83638
CAGGAGG176200.018.0043643
CCGGGGA30350.017.9134184
ACCCTAT95950.017.58951614-15
CAACGAT77900.017.4200133
AGGAGGT172750.017.3222737
GAGGTGA174550.017.2991759
CGGGGGT31600.017.2051378
GCAGGAG187100.017.1560062
GCCGGGG33800.016.7506943
ACCAGGC112900.016.36752578-79
GTGACCC90950.016.25635312-13
GACCCTA91300.016.09777514-15
GTCATCC109350.016.0103750-51
CTCTACC105150.015.9717522-23
GGAGGTG195550.015.9693358
CGATGAT89450.015.5712356