FastQCFastQC Report
Tue 15 Mar 2016
60_Embryo23B_140204_L008_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename60_Embryo23B_140204_L008_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences19637927
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG269990.13748396151997103No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT260540.13267184464022094No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT225780.11497140202221955No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCAACG47900.031.0717681
GTGAGCC51200.020.5942994
GCAACGA78300.020.0325342
CAGGAGG157500.019.465383
CAACGAT81600.018.7309133
CAGCTTA93150.018.5742794
CGATGAT86450.017.4753196
CCCCGGA25700.017.1655243
AGGAGGT166300.017.1510757
GCAGGAG181500.016.989652
GAGGTGA169550.016.954699
AACGATG91650.016.4824684
ACCAGGC110950.016.45981878-79
CCAGGCT99650.016.28880180-81
GTCATCC103650.016.14455650-51
GGAGGTG185700.015.6716978
TGCAGGA194100.015.5883171
GTGACCC92250.015.29325812-13
ACCCTAT108700.015.25633914-15
CTCTACC108400.015.23973822-23