FastQCFastQC Report
Tue 15 Mar 2016
6-Wingbud11A_131203_L002_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename6-Wingbud11A_131203_L002_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences24485287
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG483170.19733074805290213No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT261960.10698669776670375No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAGGAGG234700.023.0810263
ACCCTAT131600.022.68315514-15
ATGCGGG59900.021.8708275
GAGGTGA227700.021.726849
TGCGGGG59950.021.4763876
ACCAGGC150500.021.44696478-79
GGGGGTA62850.021.349949
GCAGGAG252900.021.0013182
GTCATCC146300.020.77527450-51
CCGGGGA41150.020.310344
AGGAGGT247550.020.129517
CTCTACC149850.020.04425822-23
GAGCGCG61900.019.7799029
GACCCTA129200.019.09926414-15
TGCAGGA276450.018.8689061
GTGACCC132300.018.63172712-13
CAGGCTT177000.018.55269480-81
CCTATTC162850.018.45951516-17
CGGGGGT68100.018.3100578
TGAGCGC68450.018.084438