FastQCFastQC Report
Tue 15 Mar 2016
59_Embryo23A_140204_L008_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename59_Embryo23A_140204_L008_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15185523
Sequences flagged as poor quality0
Sequence length10-100
%GC37

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT182610.12025269067123996No Hit
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT174460.11488573689559457No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCCCGA23100.032.4558451
GGTGTGC55400.030.6079066
CCTGACC44350.030.3086953
GCCCCGT17450.027.7108151
GCCCCGA15500.026.0452141
CCCCGAT22650.025.2661882
GTGTGCT75850.025.0536637
CTGACCT57200.023.344724
CCCCGTT36500.022.72832
GTGCTCT84650.022.3549279
CCCCGAC19500.022.2951152
CCCCGTA19900.022.2928282
GACCTAA63250.021.9666486
GGGTGTG45650.021.7753755
ATAATCG59800.021.69666194
TGTGCTC88500.021.6286148
GGGGGCT22900.021.503331
TGACCTA63200.021.4863555
CCCGAAT32300.021.4259623
GCCCGTA16700.021.2516062