FastQCFastQC Report
Tue 15 Mar 2016
59_Embryo23A_140204_L008_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename59_Embryo23A_140204_L008_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15185523
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG356910.23503306405712865No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT244620.16108763590164132No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT234800.15462095049344038No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTGAGCC43000.024.3575994
CAGGAGG151250.024.3058133
GAGGTGA155000.022.011999
ACCAGGC116400.021.51267678-79
AGGAGGT157450.021.468617
GCAGGAG168750.021.3862132
GTCATCC110050.021.33936550-51
ACCCTAT108200.021.31140914-15
TGCAGGA169550.021.1794071
GGTGACC111300.020.53167310-11
CTCTACC111900.020.3532222-23
TACCACG45700.020.2361749
TGACCCT111450.020.20397812-13
CAGGCTT125200.020.12819980-81
GGAGGTG172500.019.9345118
CCTATTC116000.019.7856316-17
TAGCCCC18100.018.8476261
CGATGTT81800.018.5474851
GTGACCC97100.018.403912-13
CCGCCGT43550.018.346512