FastQCFastQC Report
Tue 15 Mar 2016
58_Embryo17B_140204_L008_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename58_Embryo17B_140204_L008_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17278152
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT392390.2271018335757204No Hit
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT350160.20266056231013596No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCCCGA27350.035.2519951
CCTGACC62000.032.8213423
GCCTAAC41350.030.1934072
GCCCCGT21850.030.0948091
CTGACCT72850.028.2989924
TGACCTA76850.026.9501745
GACCTAA84100.025.1085436
CTAGGCG38650.024.20920238-39
CCCCGTT40700.023.4706612
CCCCCGT23900.023.2377151
CCCGGTA30350.022.9838893
TAGGCGC41150.022.79333738-39
CCCCGTA23800.022.7753032
GGCGCTA40750.022.72792440-41
GACCCGA11800.022.5917841
GCCCGGT26250.022.5114572
CCTAGGC41850.022.47949436-37
CCCCGAA42850.022.396712
CGGTACC32900.022.2898755
CTATTGG72200.022.2276676