FastQCFastQC Report
Tue 15 Mar 2016
56_Embryo11B_140204_L007_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename56_Embryo11B_140204_L007_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16211305
Sequences flagged as poor quality0
Sequence length10-100
%GC37

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT238420.14707020810477625No Hit
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT172370.10632703536205136No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCCCGA23050.031.2357961
CCTGACC45100.029.8590433
GCCCCGT18000.028.641381
CCCCGTT29200.025.8747332
GCCTAAC33650.025.6227932
ATAATCG64450.024.64507394
GGGCCGT15350.023.4522821
CTGACCT59750.022.3891934
AAACCCG50950.022.38334376-77
CCCCCGT16900.022.0902711
ACCTGAC55650.022.042142
GGGGGTT38400.021.1801171
CCCCGTA21250.021.123812
AGGTGGG41750.020.971023
ATAGGGT38350.020.86347494
TGACCTA65350.020.8162365
GGCCCCT22250.020.7736021
GACCTAA65600.020.6751986
GGGCCCT21500.020.6714061
AACCCGA52300.020.6654176-77