FastQCFastQC Report
Tue 15 Mar 2016
56_Embryo11B_140204_L007_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename56_Embryo11B_140204_L007_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16211305
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG859300.5300622004212493No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT294200.181478295547459No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT248840.15349782142770121No Hit
CAACAGCCAAGTCAATGACCTTCGTGGCAAGTTCATGAAACCCACTCTGA216070.13328353269523951No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAGGAGG226600.038.397813
GAGGTGA230700.036.5282559
AGGAGGT231300.036.4317057
TGCAGGA248450.034.586091
GCAGGAG252950.034.077572
GGAGGTG252100.033.9798858
ACCCTAT155100.031.32387514-15
ACCAGGC180950.029.44386778-79
CTCTACC170250.028.78667322-23
GTCATCC174150.028.6658250-51
GACCCTA152200.028.16359914-15
GGTGACC173650.028.1283610-11
CAGGCTT191950.027.8584380-81
TGACCCT177050.027.32302312-13
CCTATTC179150.027.31214516-17
CCAGGCT173450.027.115780-81
GTGACCC161150.026.58255612-13
TACCAGG182600.025.87517478-79
AACAGCC86750.025.8401132
CCAAGTC84700.025.6160957