FastQCFastQC Report
Tue 15 Mar 2016
55_Embryo11A_140204_L007_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename55_Embryo11A_140204_L007_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22421385
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG439980.19623230233101122No Hit
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT246900.11011808592555723No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCAACG53450.031.2168121
GGACCGA86600.026.145245
GACCGAC86800.025.8333036
AGGACCG92000.024.5149334
ACCGACT93550.024.016687
CAGGAGG190850.022.7401223
GAACCCG68900.021.8650531
CGGTCTA81800.021.790686
CCGACTG105000.021.7320828
GCAGGAG206300.021.3555152
CAGCTTA98150.021.31841394
GAGGTGA198300.021.2702229
CGACTGA110550.020.7606539
AGGAGGT204750.020.6201827
CAGGACC115250.020.2913823
CAACGAT84650.020.228383
CCCGACT76050.020.2124614
CCGACTC75850.019.9197335
ACCCTAT117350.019.82590114-15
TGCAGGA225000.019.7947371