FastQCFastQC Report
Tue 15 Mar 2016
54_Embryo21B_140204_L007_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename54_Embryo21B_140204_L007_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences19267495
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAG337750.17529523168424332No Hit
GGCCGGCATCTGCATCGGGTTTCCCCTAGGGCTTAGGATCGACTGACTCG230510.11963672496087321No Hit
ACTCTGATCGTTTTTTCACTGACCCGGTGAGGCGGGGGGGCGAGCCCCGA215600.11189830333419057No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTGAGAG238700.080.7573894
GGCCGGC60000.042.5052831
TAGTAGC390600.040.866117
GTAGCAA404300.039.5832149
GTCCTGA294400.039.56514790-91
GGCCCTG73750.038.7932394
GAGGGGT117450.038.4402439
TCGGTCC309200.038.4295488-89
GATCGTT94000.037.887776
AGTAGCA426950.037.5913168
GTCGGTC312350.037.2904286-87
AGTCGGT314400.037.2852186-87
CGGTCCT322900.036.58021588-89
TGATCGT93000.035.861155
TCAGTCG338150.035.66937684-85
ACGCCCC52000.035.5791194
CAGTCGG328650.035.23142684-85
GCTAGAG69400.035.17849394
CCTGAGA277600.034.855892-93
GCACGTC100450.034.8111494