FastQCFastQC Report
Tue 15 Mar 2016
54_Embryo21B_140204_L007_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename54_Embryo21B_140204_L007_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences19267495
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT802540.4165253448878538No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG784180.4069963428042929No Hit
GGACCGTGAAGCGACAATATTTCTCAGGAGTCCCCGAGTCGAACAAGGCT765700.3974050596613623No Hit
GAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGT677030.35138454687545007No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC607140.3151110198808927No Hit
AAGGCTAAATACAACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAA546700.2837421263116975No Hit
CACGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCC469540.24369540513699367No Hit
GAAAGAGTTGAAGGAAAGACAAAAGCAGCAGCTGAGGCACAAAGCTTTGA409670.21262234659980447No Hit
TGGTAGTAGTAGCAAATACTCTAGCGAGACCCTGGAGGGCTGATGTGGAG367710.19084473617353995No Hit
AAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCCAACGCTTGGTG363610.18871679997840923No Hit
CGATGTTGGATTAAGAAAATTATTAGGTGCAGAAGCTTAATTTATTGGTC312120.16199303542053597No Hit
GTAAGGAGACATGAGAGGTGTAGCATAAGTGGGAGACGTTTCGGCGTCGC304290.1579291962966644No Hit
CCCCACCTGGCACTGTCCCCGGAGCGGGTCGC281460.14608022475158292No Hit
AGCCCTTAGAGCCAATCCTTATCCCGAAGTTACGGATCCGGCTTGCCGAC229140.11892568286640272No Hit
CAACAGCCAAGTCAATGACCTTCGTGGCAAGTTCATGAAACCCACTCTGA223910.11621126669554085No Hit
CAGCTCAGGCGTGAGTACCCCCTAAATTTAAGCATATTAATAAGGGGAGG199510.10354745129037272No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCCTCGG124500.077.0419694
CAGCTTA137150.053.4598694
GGACCGT150300.051.531871
CTAAGCC88150.049.0878594
CCGCCCA105650.048.01055594
CCCACCT144950.044.920682
GACCGTG174550.044.673452
ACCTGGC146600.044.0883645
CCCCACC150800.043.1780741
CACCTGG151700.042.9219064
CCGTGAA189650.041.370344
GGCTAAA207050.039.732353
TGAAGCG196950.039.4850357
CCACCTG168050.039.240673
CAGGAGG198550.039.229413
ACGACCT78450.038.3757741
GTCCTCG126100.038.25569592-93
GTGAGCC50550.038.16345694
CCTGGCA169250.038.0084046
AGGCTAA217100.037.51012