FastQCFastQC Report
Tue 15 Mar 2016
54_Embryo21B_140204_L007_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename54_Embryo21B_140204_L007_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences228631
Sequences flagged as poor quality0
Sequence length10-100
%GC43

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GGACCGTGAAGCGACAATATTTCTCAGGAGTCCCCGAGTCGAACAAGGCT7010.30660759039675284No Hit
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT5070.22175470517996249No Hit
GAAAGAGTTGAAGGAAAGACAAAAGCAGCAGCTGAGGCACAAAGCTTTGA4660.20382187892280576No Hit
GTAAGGAGACATGAGAGGTGTAGCATAAGTGGGAGACGTTTCGGCGTCGC3870.16926838442730863No Hit
GAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGT3520.1539598742077846No Hit
AAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCCAACGCTTGGTG3290.14389999606352596No Hit
CACGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCC3130.1369018199631721No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG3100.13558966194435576No Hit
CAGCTCAGGCGTGAGTACCCCCTAAATTTAAGCATATTAATAAGGGGAGG3070.13427750392553942No Hit
AAGGCTAAATACAACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAA2510.10978388757430094No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC2410.10541002751157978No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCCTCGG950.087.8137294
CTAAGCC559.3566996E-784.2656994
GTCGATC303.4605855E-667.6762386-87
CCGCCCA808.659548E-657.93266794
GTCCTCG801.8189894E-1257.09995792-93
AATCGGA703.1311097E-452.9670194
TAGGCTC200.00773408351.0902253
GCGACGC550.00804242650.55941494
ACCCGCC352.445815E-548.6573562
CGTCCTC851.8735591E-1048.3670292-93
GGTAAGC659.054929E-846.66157590-91
GTCAGTC654.9385562E-946.6323882-83
TGGTAAG701.6215381E-743.328690-91
CAGTCGA553.0121755E-642.86642584-85
AACCGCC653.3706692E-642.16612292-93
TCGATCC505.9800783E-541.8160688-89
GGACCGT2300.041.4645271
TCGTCCT1055.4569682E-1141.26533590-91
CGTCTCG1006.548362E-1140.60573686-87
CGAGTCA907.37872E-540.332380-81