FastQCFastQC Report
Tue 15 Mar 2016
53_Embryo21A_140204_L007_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename53_Embryo21A_140204_L007_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22662186
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT1303400.5751431040235925No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG749650.3307933312346832No Hit
CACGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCC700710.30919788585267105No Hit
GAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGT699310.3085801166754169No Hit
AAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCCAACGCTTGGTG553220.24411590302894876No Hit
GGACCGTGAAGCGACAATATTTCTCAGGAGTCCCCGAGTCGAACAAGGCT347740.15344503835596443No Hit
AGCCCTTAGAGCCAATCCTTATCCCGAAGTTACGGATCCGGCTTGCCGAC275120.12140046860439677No Hit
TGGTAGTAGTAGCAAATACTCTAGCGAGACCCTGGAGGGCTGATGTGGAG274290.12103421973502466No Hit
CGATGTTGGATTAAGAAAATTATTAGGTGCAGAAGCTTAATTTATTGGTC272580.12027965881137856No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC270510.11936624295643854No Hit
CCCCGGGGCTCCCGCCGGCTTCTCCGGGATCGGTCGCGTTACCGCACTGG240650.10619010893300408No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCCTCGG92650.051.89864394
GGACCGA306400.038.8556145
CTAAGCC99650.037.7354994
GGACCGT101050.037.648821
ACCGACT317350.037.5458347
GACCGAC318200.037.4299966
CAGCTTA97000.036.21253694
CCGACTG332750.035.8999568
CCCACCT142500.035.3546942
AGGACCG339800.035.085994
CGACTGA340750.035.0842139
TCAGGAC351150.033.927362
CACCTGG154100.033.6170354
ACCTGGC149600.033.3895385
CCCCACC154800.033.186381
CAGGACC364750.032.934343
CACCAAG170700.032.78294494
CGGTCTA261700.032.0109866
CAGGAGG227850.031.9174083
CCACCTG164850.031.3463463