FastQCFastQC Report
Tue 15 Mar 2016
53_Embryo21A_140204_L007_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename53_Embryo21A_140204_L007_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences217713
Sequences flagged as poor quality0
Sequence length10-100
%GC44

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT6560.3013141153720724No Hit
AAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCCAACGCTTGGTG4420.20301957163789025No Hit
CACGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCC3980.18280947853366586No Hit
GAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGT3190.14652317500562667No Hit
GGACCGTGAAGCGACAATATTTCTCAGGAGTCCCCGAGTCGAACAAGGCT2790.12815036309269542No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG2510.11528939475364355No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCCTCGG606.969588E-571.741794
TCGATCC500.00465131658.05651588-89
ACCATCG600.00628112453.8062794
CCAGGCT553.5372068E-852.57352480-81
CTAAGCC650.00861945249.66732494
GTCGGAA650.00861945249.66732494
GGCGGTT200.0099780347.899647
ACCAGGC752.1464075E-1047.7012178-79
CCGTCTC805.738392E-446.83881486-87
CAGGCTT802.7830538E-1046.47124580-81
CATTTGC1008.6910854E-443.04501794
GGTATCC309.2196115E-442.577467
GTCCGTC601.0787076E-437.8270184-85
GCGTCCG708.339339E-636.9532982-83
TTACCAG953.074092E-936.36171376-77
CGGTCTA2400.035.8832666
CGACGGT2500.035.5432783
GACGGTC2600.035.396814
GAATAAT2008.036168E-735.27430790-91
TCCGTCT651.7274049E-434.91723684-85