FastQCFastQC Report
Tue 15 Mar 2016
52_Embryo8B_140204_L007_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename52_Embryo8B_140204_L007_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences21391717
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC472100.22069289716201834No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG396220.18522122371009303No Hit
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT375060.17532954460831732No Hit
GAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGT373150.1744366756534784No Hit
GAAAGAGTTGAAGGAAAGACAAAAGCAGCAGCTGAGGCACAAAGCTTTGA244190.11415165972885673No Hit
AAGGCTAAATACAACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAA236660.11063160568176925No Hit
TGGTAGTAGTAGCAAATACTCTAGCGAGACCCTGGAGGGCTGATGTGGAG225120.10523699430017702No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAGCTTA147550.040.11547594
CGCAACG59850.039.7512931
GAACCCG97800.036.8498841
CCGCCCA66650.035.18462494
CCCGACT103950.034.627354
CTAAGCC76750.034.3447794
CCGACTC104950.034.340355
GACTCCC106050.033.862377
AACCCGA117550.031.1458422
CGACTCC118550.030.402696
ACCCGAC119500.030.268923
ACTCCCT120050.029.951728
GGACCGA122900.028.0342375
CAACGAT90850.027.3026713
GACCGAC127200.027.0535456
GCAACGA91450.026.979012
CTCCCTT138100.026.1663659
CCCAAAG175050.026.0770156
TCCTCGG64750.026.03961694
GGCTAAA143450.025.768143