FastQCFastQC Report
Tue 15 Mar 2016
51_Embryo8A_140204_L007_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename51_Embryo8A_140204_L007_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences30119603
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC1015340.33710271679211706No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG906140.30084725884335195No Hit
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT477030.15837858155036108No Hit
AAAAGGTGAAGTAGTAGTAATTAGTTTTATACAATAAAATTGTTTTTGAT373090.1238694945613991No Hit
CGATGTTGGATTAAGAAAATTATTAGGTGCAGAAGCTTAATTTATTGGTC329740.10947687457899097No Hit
AAGGCTAAATACAACCACGAGACCGATAGCGAACAAGTACCGTGAGGGAA306950.10191037378547121No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAGCTTA240250.052.19713694
CCCAAAG293000.032.7474756
TCCTCGG98500.031.45246594
CGGTTAG99600.031.34299994
GGACCGA145600.030.871915
GACCGAC149950.030.0652626
CAGGAGG307950.029.8800723
GAAACCC319950.029.5735992
ACCCAAA332900.028.9545635
GGACCGT90650.028.4452081
AACCCAA340100.028.3017924
AGGACCG161350.027.912284
ACCGACT163650.027.7920557
TGCAGGA335150.027.4155481
GAGGTGA324150.027.178579
CGGTCTA119050.027.001496
TCAGGCG116050.026.7097035
GCAGGAG347000.026.5429342
AGGAGGT337100.026.0671627
TTAGTCC185750.025.8268726-27