FastQCFastQC Report
Tue 15 Mar 2016
50_Embryo6B_140204_L007_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename50_Embryo6B_140204_L007_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences240120
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT5080.21156088622355487No Hit
AAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCCAACGCTTGGTG2910.12118940529735132No Hit
CACGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCC2820.11744127936031984No Hit
GAAAGAGTTGAAGGAAAGACAAAAGCAGCAGCTGAGGCACAAAGCTTTGA2520.10494752623688156No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG2430.10119940029985007No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAGCTTA902.0612606E-763.17292894
TATGCCT705.4958474E-447.26705686-87
TCGCTAA407.325808E-444.60932590-91
GAGTTGA1700.038.240715
AGAGTTG1700.038.1770064
CGCAACG451.05949955E-437.9537471
GTACGTG900.002238869235.52707784-85
ACCCCCC851.0167332E-634.28484786-87
GCCCTTA905.678885E-934.158372
CGATTTA551.5764102E-533.68602868-69
GGACCGA1350.032.9481355
CCCACCT959.624273E-932.360562
TAGAGCC851.2711462E-732.2632757
CCGGTGC650.004445432730.89703656-57
GACCCCG1001.10958354E-1030.66474362-63
CGACTGA1600.030.0890859
ATACTTA703.461267E-530.02260676-77
GCACCTC1151.8462742E-929.75255
CACCTCA1052.4836481E-829.3580826
CACCTGG1052.5500412E-829.2786054