FastQCFastQC Report
Tue 15 Mar 2016
5-Wingbud8A2_131203_L002_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename5-Wingbud8A2_131203_L002_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22724078
Sequences flagged as poor quality0
Sequence length10-100
%GC37

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT414570.18243644472616227No Hit
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT255180.11229498508146293No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCCCGA33150.032.8476831
CCTGACC80800.030.8905623
CCCCGAT26850.027.2035352
GCCCCGT25950.027.1109221
CTGACCT95100.026.057134
TGACCTA101550.024.500815
ACCTGAC91250.024.0136412
GACCTAA105750.023.6254146
GGCCCCT32250.023.343261
CCCCGTT53950.023.1736662
GCCTAAC48750.023.16372
CGGTACC51200.023.027845
GTCCCGT39900.022.4615151
CCCGCCG37500.021.9363694
GCCCCGA20850.021.9217951
CCCCGAA53200.021.7315182
GGGGGGT27150.021.6213841
GGGCCGT21400.021.3583851
CCCGAAT58000.021.1692073
GCCCGGT39550.021.0740722