FastQCFastQC Report
Tue 15 Mar 2016
5-Wingbud8A2_131203_L002_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename5-Wingbud8A2_131203_L002_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22724078
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT459280.2021116104248542No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT411140.18092703255111164No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG263380.11590349232210874No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGGGGT35550.030.6301298
CGTCTCG77800.025.4149467
CCGGGGA42600.025.3467664
CGTCCGT79400.024.8470653
GTCCGTC83300.024.0106184
GGCGTCC83350.023.5724141
GCCGGGG48600.023.062513
TGCGGGG53150.021.4293066
ATGCGGG52800.021.052955
TCCGTCT96600.020.4205685
CCGTCTC101200.020.0332266
GGTGTGC161950.019.0733837
ACCCTAT107250.019.01578714-15
GCGGGGG60150.018.935797
GGGGGTA62400.018.9112829
GTGTGCT266250.018.6007488
ACCAGGC118100.018.15408978-79
GTCATCC116450.017.69710550-51
CAGGAGG211250.017.5995333
GGCCGGG83450.017.207452