FastQCFastQC Report
Tue 15 Mar 2016
48-Wingbud6A1_131203_L006_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename48-Wingbud6A1_131203_L006_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14589820
Sequences flagged as poor quality0
Sequence length10-100
%GC37

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT284490.1949921246458147No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTGACC51500.037.557843
CCCCCGA15200.031.4355371
CTGACCT65200.030.6303944
CGGTACC26500.030.6212985
TGACCTA65550.030.2161885
GCCCGGT19500.028.7542232
GACCTAA70300.028.2532756
GCCCCGT15600.028.1291331
CCGGTAC28850.026.7523634
CGGCGGT51500.026.45146490-91
CCCGGTA25350.026.3305533
GCCCCGA12300.026.162381
GCCTAAC35700.024.5834452
CTGACGG58150.024.40820386-87
CCCCGTT30750.023.7839812
GGGCCGT11300.023.7313631
CCCCGTA17350.023.3247532
GGGGGGT21350.023.293821
ATAATCG51450.023.09232194
GCGGTAT51900.022.96065792-93