FastQCFastQC Report
Tue 15 Mar 2016
48-Wingbud6A1_131203_L006_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename48-Wingbud6A1_131203_L006_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14589820
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT309740.21229871238987183No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT308420.21139397196127163No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG248840.1705572789794528No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGGGGT18750.028.5091178
GCCGGGG25950.024.7150763
CAGGAGG133250.022.5952053
CAGCTTA75650.022.36498594
CCGGGGA28350.021.8372044
GGCCGGG30550.021.7254312
AGGAGGT134150.021.1845347
GAGGTGA132650.021.0903119
GCAGGAG140900.021.0234532
ACCCTAT76150.019.84001514-15
GTCATCC77300.019.42935650-51
ACCAGGC80400.019.33429578-79
GTGACCC69450.019.21567512-13
GGAGGTG151450.019.1770638
CGGCTCG12350.019.1150536
GAAACCC76250.018.9277292
CTCTACC76850.018.85828622-23
CTTAGGT50250.018.7928711
ATGCGGG31050.018.6481135
CCAGGCT78200.018.46118480-81