FastQCFastQC Report
Tue 15 Mar 2016
47-FW11B1Ovary_131203_L006_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename47-FW11B1Ovary_131203_L006_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences28721838
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG304640.10606563549310458No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGACCA63150.035.7254835
CGACCGA51300.034.330026
ACGACCG54500.032.47355
CGCAACG61750.031.8560121
ACCATCG81950.031.56733394
CCGAGCG60850.029.3793969
ACCGAGC61350.028.7094278
AACACGG84700.027.724481
GACCGAG66350.026.6764347
GACGACC69750.025.3724984
ACACGGA99000.024.295132
CGGATCG40350.023.94435386-87
CCGGGCG63700.023.73980576-77
AGCCGGG63000.023.66441774-75
ACGGACC98300.023.2617864
ATCGGGC45150.022.75122590-91
CGCGGTT69500.022.58994586-87
CACGGAC104550.022.332283
GCCGGGG44750.021.4378383
CATGACG87100.021.1258011