FastQCFastQC Report
Tue 15 Mar 2016
47-FW11B1Ovary_131203_L006_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename47-FW11B1Ovary_131203_L006_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences603428
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA12450.20632121810721413No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCATCG2450.066.81895494
CGCGGTT1750.052.40851686-87
GCGCGGT1500.049.5366784-85
GTTGACC2200.046.78624390-91
CGACCGA1600.039.1025286
CGGTTGA2450.038.64143888-89
GGGCGCG2450.037.99300478-79
AACACGG4100.036.9594571
CCGGGCG2600.036.65481676-77
AGCCGGG2650.036.5276974-75
GGTTGAC2250.036.33856288-89
CGGACCA4200.036.0136385
ACGGACC4250.035.557514
CGGGCGC2200.035.29723476-77
ACCGAGC1800.034.8388258
ACACGGA4400.034.43952
TGACCAT3050.034.0643392-93
CATGACG2050.033.7455941
AAGCCGG2600.033.7181972-73
CACGGAC4550.033.304133