FastQCFastQC Report
Tue 15 Mar 2016
46-FW11B1Muscle_131203_L006_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename46-FW11B1Muscle_131203_L006_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences24456228
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT288620.1180149285490796No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCCCGA22900.034.5129281
CCCGCCG57650.033.15572494
CCACGTA71850.029.4231662
CACGTAT76450.028.6473143
CTACGGG52350.028.19717836-37
CGCTACG53850.027.89942634-35
CCCCGAT25500.026.4304332
TGACCTA75050.026.3021975
GACCGTC63350.026.24516914-15
GCTACGG54050.026.03335836-37
GCCCCGT21500.025.9351651
CCCCGTA24850.025.5608062
GGGGCGC43600.025.26999776-77
ATACGCC39150.024.7413087
TACGGGG56700.024.72192638-39
GGGGGTT58300.024.7011721
CCCCGTT35150.024.6920642
CCCGCTA61450.024.66483132-33
ATAATCG82150.024.57632694
GACCTAA84300.024.0481136