FastQCFastQC Report
Tue 15 Mar 2016
46-FW11B1Muscle_131203_L006_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename46-FW11B1Muscle_131203_L006_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences24456228
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG1183540.4839421680236216No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT333310.13628839247000804No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG317190.12969702441439457No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT308030.1259515572066142No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC267340.10931366848558985No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC248180.10147926327804925No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT159050.081.0872394
TTCAGCC212850.058.60681
ATGGCCT239150.052.292938
CCATGGC249050.050.156646
CAGCCAT252550.049.723523
AGCCATG260350.048.284884
CATGGCC263050.047.5563167
TCAGCCA265550.047.3277442
TGGCCTG281650.044.7037859
GCCATGG287700.044.004665
ATCGCGG155800.040.1992864-65
GGCGGTC169950.038.07629492-93
CGCGCAT167300.037.92192584-85
GGGCGGT170100.037.85965792-93
GCGCGCA164000.037.52092784-85
ATGGGCG169050.037.47840590-91
CGCGGCT171300.036.96060666-67
TCGCGGC171650.036.87146466-67
TGGGCGG169500.036.5203590-91
CCGCGCG173450.035.8804782-83