FastQCFastQC Report
Tue 15 Mar 2016
46-FW11B1Muscle_131203_L006_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename46-FW11B1Muscle_131203_L006_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences590216
Sequences flagged as poor quality0
Sequence length10-100
%GC44

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG33290.5640307955053744No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC11550.19569106903235428No Hit
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA6470.10962088455751794No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT3050.0107.0369494
ATGGGCG3350.092.0609190-91
TTCAGCC12250.057.3808631
GCAGAGC3100.057.1685794
CGCGCAT3450.054.63986284-85
ATGGCCT13400.052.080728
TCAGCCA13800.051.4210172
GCATGGG3300.050.760788-89
CCATGGC14050.049.761746
ATCGCGG4750.049.33558764-65
CAGCCAT14550.048.302143
GGCGGTC3500.048.12309392-93
TCGCGGC4850.048.08597666-67
ACGTTGT1702.0008883E-1048.04966792-93
TGGCCTG14550.047.8111539
AGCCATG14800.047.8003924
CGCGGCT4900.047.595366-67
GCGCGCA3800.047.49629684-85
GCCATGG15000.047.4538655
AGGCCGC4600.046.90559878-79