FastQCFastQC Report
Tue 15 Mar 2016
45-FW11B1Head_131203_L006_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename45-FW11B1Head_131203_L006_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences35552881
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT980040.27565698543530126No Hit
GACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT419710.11805231761667923No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTGACC137150.046.0903173
CTGACCT172700.038.1184234
TGACCTA176950.037.2473455
GCCTAAC97350.032.805562
GACCTAA211150.031.5341176
CCCCCGA38900.028.1793351
GCCCCGT37750.027.6550271
GGCCGTT73800.025.1413611
CCCCGTA39400.024.5698412
ATAATCG131100.024.53676494
GCACGTC135700.024.08504994
GGTATAT265300.023.44819894
GTCGCGT72200.023.00566384-85
CGGCGGT191750.022.83188890-91
CCCCGTT64100.022.5792872
ACCCGAC72200.022.13860960-61
GCGCGCA83500.021.59351390-91
GGGCCGT40150.021.5106851
CCCCCGT54500.021.5064561
CAACCCG76950.021.34038458-59