FastQCFastQC Report
Tue 15 Mar 2016
45-FW11B1Head_131203_L006_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename45-FW11B1Head_131203_L006_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences35552881
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT1229980.34595789860180387No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT975350.27433782370548254No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC534340.1502944304288589No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG510980.14372393618396212No Hit
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA467420.1314717645526392No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGACCA127400.039.974615
ACCATCG151150.039.76749494
CAGCTTA203100.035.3510894
AACACGG155650.034.7251551
ACACGGA166350.032.465522
CGCAACG99050.030.0824131
AGCCGGG121200.028.58892874-75
CCGCAAT120800.028.2478164
ACGGACC186050.028.2097034
CGGTTGA139750.027.2873888-89
GTCTAAC129050.026.64103316-17
CACGGAC200000.026.4154423
GGACCAA200150.026.1819026
CGCGGTT142400.025.97853986-87
ATGCCGC119650.025.7718731
CGACCGA60000.024.6857456
CCGGGGA92150.024.3422094
CGTACCA83700.024.3193041
ACCTCGG86250.024.1031767
CCGGGCG147350.024.0263676-77