FastQCFastQC Report
Tue 15 Mar 2016
45-FW11B1Head_131203_L006_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename45-FW11B1Head_131203_L006_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences778403
Sequences flagged as poor quality0
Sequence length10-100
%GC43

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA24550.31538932917781665No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCATCG4900.088.00748494
CGGTTGA3600.061.13661688-89
GTTGACC4000.057.13603290-91
CGCGGTT3800.056.2317486-87
AGCCGGG4700.049.74213474-75
TGACCAT4950.049.66030592-93
ACGTTGT3200.049.0809292-93
GGTTGAC4350.045.4329888-89
CCGGGCG5000.045.3719376-77
GCGGTTG4300.044.62243786-87
GGGCGCG5200.044.44472578-79
CAGCTTA2501.8189894E-1244.1265494
AACACGG8250.043.7371831
TTGACCA4700.043.66453690-91
CGGACCA8050.043.5356185
CGGGCGC4650.043.1885176-77
GCGCGGT4000.042.04812684-85
GAAGCCG5950.041.08370672-73
ACACGGA8750.040.872982
GCCGGGC5000.040.18231274-75