FastQCFastQC Report
Tue 15 Mar 2016
44-FW23B2Ovary_131203_L006_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename44-FW23B2Ovary_131203_L006_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences35382796
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA626160.176967360069566No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG566890.160216281381494No Hit
CATGACGACCGAGCGTCCGCATCAAGCCTATCATCAATATGGTCACCCTG467210.1320443980741375No Hit
ACCACCACTCACAAGAACTCCTGTCCCAGACAAGGGTAGTCCTTCTTTTT402600.1137841113517428No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGACCGA111000.043.103556
CGGACCA150650.043.088455
ACGACCG112250.042.7768865
ACCATCG178900.042.59401794
ACCGAGC119900.040.127298
CCGAGCG124250.038.61829
GACCGAG126650.038.367037
GACGACC129100.037.090454
AACACGG178350.036.792281
ACACGGA191200.034.914842
GGCCAGG177100.032.21953694
CATGACG155850.031.7675671
ATCGGGC90600.030.30246590-91
CGGATCG88800.030.01800586-87
GGACCAA226450.028.7831446
AGCCGGG151950.028.62339474-75
CGGTTGA169050.027.43794388-89
ACCCGCC47750.027.3193912
CGCGGTT169550.026.72673886-87
ACCACTC168150.026.3683914