FastQCFastQC Report
Tue 15 Mar 2016
44-FW23B2Ovary_131203_L006_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename44-FW23B2Ovary_131203_L006_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences736730
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA31880.4327229785674535No Hit
CATGACGACCGAGCGTCCGCATCAAGCCTATCATCAATATGGTCACCCTG10180.13817816567806387No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCATCG4300.092.89970494
CGGATCG1250.052.7962286-87
GTTGACC4800.050.7501290-91
CGACCGA3550.046.203486
CGGTTGA5250.045.4396988-89
CGCGGTT5150.044.8511686-87
TCGGGCC1600.044.2910190-91
ACGACCG3700.044.2731065
TGACCAT5950.042.4025592-93
AGCCGGG5800.041.75750474-75
GCGGCGC5500.041.58661382-83
GGATCGG1650.041.30880788-89
GGCCAGG3700.041.1293494
AACACGG9600.041.0251351
ACACGGA10050.040.1678962
CGGACCA9900.040.042575
GGGCGCG6250.039.37169678-79
CCGGGCG6150.039.0063976-77
ATCGGGC1850.038.3057490-91
ACCGAGC4300.038.2384348