FastQCFastQC Report
Tue 15 Mar 2016
43-FW23B2Muscle_131203_L006_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename43-FW23B2Muscle_131203_L006_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22295013
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TCCACGTATTTCATGACCGTCGTAACTGCCGCCCCGCTACGGGGCGGGCT346660.1554876868652196No Hit
CGTGGTTGTATTTAGCCTTAGATGGAGTTTACCACCTGCTTAGGGCTGCG230670.10346259946114407No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCACGTC190650.063.1395994
CCACGTA102950.056.1711852
CACGTAT121000.051.5485843
CCCGCCG117500.046.88796694
TCCACGT141000.040.2666241
CCGCGTA16700.039.2389832
GCGCACG194800.038.2515592-93
TCCCGGG174200.037.5322584-85
ACGTATT180900.037.5300334
CGCGTAT19350.036.804163
GCGCGCA195750.035.66562790-91
CGCACGT191050.034.87696592-93
CCTCCCG188750.034.82126282-83
CGTATTT237250.033.621435
GAGACGA201050.033.31408774-75
ATACGCC43100.033.1495677
CGAGCCT206150.032.67894778-79
CCCGACT211650.032.4675462-63
GGGGCGC92000.032.2230876-77
AACGCGC35650.032.013497