FastQCFastQC Report
Tue 15 Mar 2016
43-FW23B2Muscle_131203_L006_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename43-FW23B2Muscle_131203_L006_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences702643
Sequences flagged as poor quality0
Sequence length10-100
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC39310.5594590709649139No Hit
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG29610.42140888046988295No Hit
CAGCTCAGGCGTGAGTACCCCCTAAATTTAAGCATATTAATAAGGGGAGG17950.2554640123078149No Hit
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA16970.24151667347429634No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT15160.2157567925674916No Hit
ACGACCTCAGCTCAGGCGTGAGTACCCCCTAAATTTAAGCATATTAATAA12190.17348781671488936No Hit
CAGGCGTGAGTACCCCCTAAATTTAAGCATATTAATAAGGGGAGGAAAAG8120.11556366462058257No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATGGGCG2950.0111.87591690-91
GCGGTCT2750.0105.9272194
GCAGAGC5350.094.84589494
ACATGGG4100.087.7878788-89
ACGTTGT2750.083.8716892-93
GGGCGGT4450.064.2702192-93
GTTGTGT4150.061.13560594
CGCACAT3500.059.15484284-85
GCGCACA3650.057.83605684-85
TTCAGCC10800.057.001571
ATCGCGG5000.051.57320464-65
TCAGCCA12550.049.0531462
CAGCCAT12650.048.665373
ATGGCCT13150.048.429988
AAGGCCG4900.047.78175478-79
CCATGGC13250.047.4662326
CACATGG3900.047.29456786-87
TCCCGCA5800.046.9975890-91
GACTATC1201.6038157E-646.98384594
TCGCGGC5850.046.4722666-67