FastQCFastQC Report
Tue 15 Mar 2016
42-FW23B2Head_131203_L006_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename42-FW23B2Head_131203_L006_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences23843272
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT518810.217591780188558No Hit
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT284720.11941314094810478No Hit
GACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT242730.1018023029725115No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTGACC95500.043.6234553
CTGACCT114500.038.5761764
CCCGCCG67100.037.9540194
TGACCTA120800.036.6911965
CCACGTA69650.032.0813942
GACCTAA141300.032.019526
GCCTAAC62400.029.7770442
ATACGCC42050.029.6299047
AACGCGC31400.029.0802067
CACGTAT83150.028.6301163
GTCGCGT68250.028.24097884-85
CCCCCGA33300.028.1853561
GCACGTC91250.027.90919794
GCCCCGT27050.026.9479481
GGCCGTT62300.026.9188291
ACGGGGC62450.026.21534738-39
GGGGCGC56500.025.94594876-77
CGCTACG64900.025.66214634-35
ATAATCG85400.025.0111794
GGGCCGT27100.024.7885631