FastQCFastQC Report
Tue 15 Mar 2016
42-FW23B2Head_131203_L006_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename42-FW23B2Head_131203_L006_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences23843272
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT773440.3243850089031405No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG644660.2703739654523926No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT599010.2512281032569691No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT425930.17863739506893184No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC369930.15515068569448018No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC315100.1321546807837448No Hit
CATGACGACCGAGCGTCCGCATCAAGCCTATCATCAATATGGTCACCCTG263100.11034559350746828No Hit
CAGCCACAAGCACGTCCCCTAGAGTTTCAGCTAGTGAACAAACGCGATGT262620.11014427885568726No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT35200.047.00950694
CCGCAAT114150.042.0516244
CAGCTTA137150.036.94128494
ATGCCGC132050.035.5287361
ATGGGCC131900.035.210089
CCGGGGA104300.033.501694
CGACCGA83850.033.49786
TGCCGCA138300.033.354592
ACGACCG84450.032.9995165
GCCGGGG106150.032.3420943
ACCTCGG68400.031.4227227
CGTACCA68250.031.1062371
GACCGAG91450.030.5247367
CAGGAGG248850.029.1890643
CCTCGGA73750.029.1448338
CCGAGCG96000.028.98999
AATGGGC164450.028.3723858
CTCGGAG78000.028.2302329
GAGGTGA246750.028.099489
AGGAGGT244150.027.9664337