FastQCFastQC Report
Tue 15 Mar 2016
42-FW23B2Head_131203_L006_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename42-FW23B2Head_131203_L006_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences633186
Sequences flagged as poor quality0
Sequence length10-100
%GC44

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC13930.21999854703041444No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT10520.16614391347881982No Hit
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA8480.13392589223387757No Hit
CATGACGACCGAGCGTCCGCATCAAGCCTATCATCAATATGGTCACCCTG6530.10312925427915336No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT801.0913936E-1192.0634294
ACCATCG2400.069.0475894
GCAGAGC2950.053.05350594
GGCCAGG2450.052.60767494
CGGTTGA2200.045.36892788-89
CGCGGTT2250.044.90036886-87
ACGACCG2850.044.4072385
CGACCGA2850.043.290016
ATCGGGC1400.043.086790-91
CGGATCG1350.041.9070186-87
GCGGATC1400.040.4103386-87
GATCGGG1550.040.24662888-89
CGTCGGT2650.040.0724982-83
CCGAGCG3200.038.7146459
TCGGGCC1600.037.70086390-91
AACACGG3900.037.6021351
GACCGAG3200.037.575647
GGATCGG1550.037.5635288-89
ACACGGA3850.037.224782
TGACCAT3050.037.0303292-93