FastQCFastQC Report
Tue 15 Mar 2016
41-FW17B3Ovary_131203_L006_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename41-FW17B3Ovary_131203_L006_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences29544754
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG489380.16564023514969867No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGACCA59550.024.7253635
ACGACCG52700.024.3847965
CGACCGA53950.023.740156
ACCGAGC55750.023.1325198
ACCACTC114100.023.0971494
CCGAGCG60700.021.6780079
GCCGGGG48200.021.3283143
CGGGGGT30700.021.1457928
ACCCTAT127850.021.14110814-15
CCACTCA125200.020.911155
CAGGAGG254700.020.8480933
CCGGGGA50150.020.7594384
GACCGAG63350.020.5626987
GAGGTGA242350.020.441779
CGGATCG35950.020.36251386-87
GACGACC63800.020.0048644
ACCAGGC153000.019.82851878-79
GCAGGAG268150.019.7882482
CACTCAC131900.019.3214026
AGGAGGT252700.019.309387