FastQCFastQC Report
Tue 15 Mar 2016
41-FW17B3Ovary_131203_L006_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename41-FW17B3Ovary_131203_L006_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences582872
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA6620.11357553630985877No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGATCG200.003365795463.0523586-87
CGGTTGA1102.5233021E-854.88814588-89
GACCGAG1550.039.8055537
CGACCGA1550.039.7576146
ACCGAGC1500.039.014598
GTTGACC1654.7439062E-737.7939790-91
ACGACCG1600.036.431665
CGCTATC652.057329E-532.40921474-75
ACCATCG1852.4529829E-531.57083394
GACGACC1900.030.6398124
AACACGG1600.028.3844991
CATGACG2200.028.0158671
CGGGGGT607.6667196E-427.0934668
CCGAGCG2200.026.6353119
CCGGGGA2750.025.8736214
GCCGGGG2700.025.2284933
CGGGGTG1001.0982512E-725.2012758-59
TGACCAT2301.2731824E-424.7922192-93
AAATCGG2002.7018995E-424.33585294
CGCGGTT1251.9029996E-523.53954386-87