FastQCFastQC Report
Tue 15 Mar 2016
40-FW17B3Muscle_131203_L004_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename40-FW17B3Muscle_131203_L004_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17229408
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG1955581.1350244883631522No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT286230.16612874917118453No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC267460.15523458496078332No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC264280.1533889034376573No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG237140.13763676616166962No Hit
CAGCCACAAGCACGTCCCCTAGAGTTTCAGCTAGTGAACAAACGCGATGT174830.10147185556230372No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT222050.094.9532494
TTCAGCC262450.072.208541
CAGCCAT291800.065.16223
ATGGCCT294600.064.302568
AGCCATG302050.062.8013734
CATGGCC306500.061.686817
CCATGGC307400.061.5044176
TCAGCCA311200.061.4341962
TGGCCTG325400.058.259159
GCCATGG341050.055.885435
GGCGGTC230650.045.43757292-93
GGGCGGT232100.044.9270592-93
ATGGGCG228450.043.78508890-91
ATCGCGG224100.042.91367364-65
TGGGCGG233400.042.822690-91
GCGCGCA240500.041.38863884-85
CGCGCAT239700.041.2411184-85
CGCGGCT237850.040.5899466-67
GCATGGG245750.040.58288688-89
CCGCAAT74550.040.4791074