FastQCFastQC Report
Tue 15 Mar 2016
40-FW17B3Muscle_131203_L004_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename40-FW17B3Muscle_131203_L004_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences238937
Sequences flagged as poor quality0
Sequence length10-100
%GC46

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG31331.3112242976182007No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC7270.3042643039797101No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT3950.16531554342776547No Hit
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCC3390.14187840309370253No Hit
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCG2760.1155116202178817No Hit
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTT2540.10630417222949984No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT2200.0145.781994
TGCATCG4300.099.6535862-63
TGGGCGG2100.072.8118190-91
CGCGCAT2300.069.3004284-85
CTTAAGT400.00238565468.7257694
GGCGGTC2350.068.5648292-93
ATGGGCG2300.066.48035490-91
GCGCGCA2450.065.0575484-85
GGGCGGT2450.063.9394292-93
GCATGGG2400.063.54775688-89
GCATCGG400.003324827963.20894690-91
TTCAGCC9350.062.2184871
CGCATGG2600.058.54719586-87
CCGCGCG2700.058.3006782-83
CAGCCAT10050.057.872753
AGCCATG10050.057.872754
AAGGCCG3050.057.4718678-79
TCAGCCA10150.057.3145642
GCAGAGC1800.055.99876494
ATCGCGG3750.055.41829764-65